| Gene name |
SPBC3F6.05 |
| Gene ID |
48/C12 |
| Gene synonyms/obsolete |
rga1 |
| Gene product |
GTPase activator;
RhoGAP domain; LIM domain; involved in actin cytoskeletal
organization; involved in actin cortical patch distribution;
involved in cellular morphogenesis; involved in cell wall
biosynthesis; involved in septum formation; involved in
septation; putative GAP for Rho1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3453 |
| ORF length (spliced) |
|
| Entry clone length |
3453 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC3F6.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCCAAAGGGACGCCAA |
| Rev primer name |
SPBC3F6.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGAATCCCTAATGACTGCA |
| Amino acid length |
1150 |
| Molecular weight |
130.6 |
| Isoelectric point (calc.) |
8.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFTGLAHYLKL/LSQYIYLLRI/LSDLSNLEL/LTFKLFGLFI |
| Localization (YFP) |
periphery at cell tip
and site of septum formation; nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |