| Gene name |
SPCC1223.06 |
| Gene ID |
48/C11 |
| Gene synonyms/obsolete |
tea1 |
| Gene product |
tip elongation
aberrant microtubule-associated protein; involved in cell
polarity; involved in cellular elongation; kelch repeat
protein; target of Shk1p; phosphorylated by Shk1p; involved in
cytokinesis; involved in microtubule based movement; involved
in cell-end anchoring (required); similar to Sp tea3 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3444 |
| ORF length (spliced) |
|
| Entry clone length |
3444 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC1223.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTTTTATTTAAAAG |
| Rev primer name |
SPCC1223.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTTCGTTGTCATGGACT |
| Amino acid length |
1147 |
| Molecular weight |
127.4 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation; microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |