| Gene name |
SPAC13G6.01c |
| Gene ID |
48/C04 |
| Gene synonyms/obsolete |
rad8;
SPAC5H10.14c |
| Gene product |
zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase (E3); SNF2
family; DEAD/DEAH box helicase; involved in DNA repair;
helicase C-terminal domain; involved in nucleotide-excision
repair |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3402 |
| ORF length (spliced) |
|
| Entry clone length |
3402 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC13G6.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAAGAAAGGTACAAAA |
| Rev primer name |
SPAC13G6.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATATTCAAACAACATTTTG |
| Amino acid length |
1133 |
| Molecular weight |
128.6 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
nuclear dots by over
expression? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |