| Gene name |
SPCC4E9.01c |
| Gene ID |
48/B04 |
| Gene synonyms/obsolete |
rec11;
SPCC550.16c |
| Gene product |
region specific
activator of recombination; involved in meiotic recombination
(required); involved in sister chromatid cohesion; cohesin
complex (meiotic); chromosome arm cohesin complex (meiotic);
low similarity to WD repeat protein (probably spurious);
similar to Sp rec7 (paralog); no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3240 |
| ORF length (spliced) |
2772 |
| Entry clone length |
3240 |
| No. of intron |
8 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC4E9.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGATTCGAATTTGAATC |
| Rev primer name |
SPCC4E9.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGATAAATGGTCAGCTGTT |
| Amino acid length |
923 |
| Molecular weight |
107.4 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFKMNALLFI/LKVLFLLLL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |