| Gene name |
SPBC6B1.07 |
| Gene ID |
47/B06 |
| Gene synonyms/obsolete |
zer1; prp1 |
| Gene product |
TPR repeat protein;
involved in mRNA splicing (IGI); involved in G0 transition;
involved in cell cycle progression (implicated); involved in
poly(A)+ RNA nuclear export (implicated); does not
functionally complement Sc PRP6 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2721 |
| ORF length (spliced) |
|
| Entry clone length |
2721 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC6B1.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAAACTTTTATCCAGA |
| Rev primer name |
SPBC6B1.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAACACATTTATGGCAAGA |
| Amino acid length |
906 |
| Molecular weight |
103 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIPMSIDLWL/LQLLENALKI/LLCTIARMLWL |
| Localization (YFP) |
nucleus |
| Comments for localization |
one nuclear dot by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |