| Gene name |
SPAC16A10.03c |
| Gene ID |
47/A12 |
| Gene synonyms/obsolete |
pep5 |
| Gene product |
involved in
intracellular protein transport; involved in vacuole fusion;
similar to Sp SPAC823.12 (paralog); zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase (E3) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2677 |
| ORF length (spliced) |
2583 |
| Entry clone length |
2677 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC16A10.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATATAAACGAGGTAGA |
| Rev primer name |
SPAC16A10.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAACATAACTGAATCAATA |
| Amino acid length |
860 |
| Molecular weight |
99 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNFCFLKPLLL |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |