| Gene name |
SPAC26H5.06 |
| Gene ID |
45/H02 |
| Gene synonyms/obsolete |
pot1 |
| Gene product |
telomere end-binding
protein; single-stranded telomeric DNA-binding protein;
involved in telomere maintenance; involved in
telomerase-dependent telomere maintenance; involved in
protection of chromosome ends; involved in chromosome
stability (required); no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1786 |
| ORF length (spliced) |
1668 |
| Entry clone length |
1786 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC26H5.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAGAGGACGTTATTGA |
| Rev primer name |
SPAC26H5.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACAATTTTCGTGCCAAAT |
| Amino acid length |
555 |
| Molecular weight |
64.1 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus;
nuclear dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal,
DeltaVision |