| Gene name |
SPAC821.12 |
| Gene ID |
45/F06 |
| Gene synonyms/obsolete |
orb6 |
| Gene product |
serine/threonine
protein kinase; Ndr kinase family; involved in cell polarity
(maintenance) (required); involved in cell cycle regulation;
involved in osmotic stress; essential; possibly functions
downstream of Shk1p; interacts physically with Skb1p; Skb1p
affects the localization of Orb6p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1722 |
| ORF length (spliced) |
1410 |
| Entry clone length |
1722 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC821.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATAAGAATGATTACTT |
| Rev primer name |
SPAC821.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAATGCTCCTTTCATCGTT |
| Amino acid length |
469 |
| Molecular weight |
54.6 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYYAFQDSLYL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |