| Gene name |
SPBP4G3.01 |
| Gene ID |
45/F05 |
| Gene synonyms/obsolete |
SPBC8E4.01c |
| Gene product |
inorganic phosphate
transporter; MFS inorganic phosphate transporter |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
1719 |
| ORF length (spliced) |
|
| Entry clone length |
1719 |
| No. of intron |
0 |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned/another
clone |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPBP4G3.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATTTGGGAGCAAAAT |
| Rev primer name |
SPBP4G3.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAGATTCCATTAAAATAC |
| Amino acid length |
572 |
| Molecular weight |
63.6 |
| Isoelectric point (calc.) |
8.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
11 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|