| Gene name |
SPAC19B12.02c |
| Gene ID |
45/D12 |
| Gene synonyms/obsolete |
|
| Gene product |
GPI anchored protein
(pers. comm. Birgit Eisenhaber); glycosidase; involved in the
regulation of the crosslinking of beta-1,6-glucans in the cell
wall; glycoprotein; similar to Sp SPBC29A10.08 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1629 |
| ORF length (spliced) |
|
| Entry clone length |
1629 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC19B12.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGTTCAGTATTCTATC |
| Rev primer name |
SPAC19B12.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATAAACAAAACAGCAGTG |
| Amino acid length |
542 |
| Molecular weight |
58.1 |
| Isoelectric point (calc.) |
3.7 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no transformant |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|