| Gene name |
SPAC6F6.08c |
| Gene ID |
44/A11 |
| Gene synonyms/obsolete |
cdc16; bub2 |
| Gene product |
TBC domain protein;
involved in spindle assembly checkpoint; involved in
cytokinesis; involved in septation (regulation) (negative);
GTPase-activating protein of Rab-like GTPase; GAP for Spg1p;
essential; two-component GEF for the GTPase spg1 (with
byr4) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1238 |
| ORF length (spliced) |
900 |
| Entry clone length |
1238 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
932T:C |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC6F6.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCGAGTATTGACTGCAA |
| Rev primer name |
SPAC6F6.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGTTAGTCGGTCAATCAGA |
| Amino acid length |
299 |
| Molecular weight |
33.9 |
| Isoelectric point (calc.) |
8.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB;
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |