| Gene name |
SPBC354.06 |
| Gene ID |
43/A02 |
| Gene synonyms/obsolete |
|
| Gene product |
mitochondrial
ribosomal protein S16; non-essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
720 |
| ORF length (spliced) |
291 |
| Entry clone length |
720 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
212G:A |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC354.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTAGTAAAAATTCGTTT |
| Rev primer name |
SPBC354.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAAAATAGATAAAGAGAG |
| Amino acid length |
96 |
| Molecular weight |
10.9 |
| Isoelectric point (calc.) |
10.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |