| Gene name |
SPAC10F6.12c |
| Gene ID |
43/A01 |
| Gene synonyms/obsolete |
mam4 |
| Gene product |
protein-s
isoprenylcysteine o-methyltransferase; farnesyl cysteine
carboxyl methyltransferase that modifies M-factor; cells
defective in mam4 do not secrete active mating pheromone
M-factor |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
711 |
| ORF length (spliced) |
|
| Entry clone length |
711 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC10F6.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGAATTTACATACGTC |
| Rev primer name |
SPAC10F6.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGGAATTAAGGGAATTCCA |
| Amino acid length |
236 |
| Molecular weight |
26.5 |
| Isoelectric point (calc.) |
9.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
5 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER |
| Comments for localization |
strong signal of
peripheral ER |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |