Gene name |
SPAC13C5.07 |
Gene ID |
40/H02 |
Gene synonyms/obsolete |
rad32 |
Gene product |
exonuclease; involved
in DNA repair; involved in double-strand break repair
(required); involved in meiotic recombination (required);
involved in meiotic gene conversion (required); involved in
end joining; involved in telomere maintenance; involved in
telomerase-dependent telomere maintenance; involved in DNA
damage sensitivity; involved in DNA replication; Mre11 complex
(multisubunit endonuclease); phosphoprotein; essential
phosphoesterase motif |
Entry clone |
Cloned in 2006
trial |
ORF length (unspliced) |
2156 |
ORF length (spliced) |
1950 |
Entry clone length |
2156 |
No. of intron |
4 |
Sequence status |
Partially
sequenced |
Sequence results |
100% match in both
ends |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC13C5.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCAAATGACCCCTCAGA |
Rev primer name |
SPAC13C5.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCATCTAAAATTTCGTCA |
Amino acid length |
649 |
Molecular weight |
73.6 |
Isoelectric point (calc.) |
5.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
574 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYQALRSLRL/LQKGFTKLAL |
Localization (YFP) |
no expression clone
|
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|