| Gene name |
SPBC4F6.04 |
| Gene ID |
40/A06 |
| Gene synonyms/obsolete |
rpl2502; rpl23a-2;
rpl25b |
| Gene product |
60S ribosomal protein
(subunit L25); similar to Sp rpl2501 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
694 |
| ORF length (spliced) |
426 |
| Entry clone length |
694 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
285T:C / 636T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC4F6.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCGTTGGTAAAGCAAA |
| Rev primer name |
SPBC4F6.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGGAAGCCAATGCGGTTG |
| Amino acid length |
141 |
| Molecular weight |
15.7 |
| Isoelectric point (calc.) |
11.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
mitochondrion? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |