| Gene name |
SPBC646.12c |
| Gene ID |
39/F10 |
| Gene synonyms/obsolete |
src1; sar1; gap1 |
| Gene product |
GTPase-activating
protein; GTPase-activating protein; no apparent Sc
ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2301 |
| ORF length (spliced) |
|
| Entry clone length |
2301 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
62C:T / 893G:A /
1053T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC646.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTAAGCGGCACTCTGG |
| Rev primer name |
SPBC646.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTTCGTAAAAACAATTGT |
| Amino acid length |
766 |
| Molecular weight |
87.5 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFNMDALLQI/LLDELSTLRL/LYHLFEQLFL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
cytoplasmic dots by
over expression? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |