| Gene name |
SPBC543.03c |
| Gene ID |
39/F09 |
| Gene synonyms/obsolete |
|
| Gene product |
putative DNA helicase
DNA helicase; Ku domain protein; involved in DNA repair;
involved in double-strand break repair; involved in telomere
maintenance (required); involved in double-strand break repair
via nonhomologous end-joining; involved in control of
replication timing in telomeric regions; interacts physically
with pku70p; forms a heterodimer with pku70p; DNA-binding
protein; telomere binding |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2227 |
| ORF length (spliced) |
2088 |
| Entry clone length |
2227 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC543.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGATAAGGAATGTAC |
| Rev primer name |
SPBC543.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATGTTATTAAAATTATCA |
| Amino acid length |
695 |
| Molecular weight |
79.8 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDNCILDLKL/LQSLQSLRL |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |