| Gene name |
SPAC57A7.11 |
| Gene ID |
39/D06 |
| Gene synonyms/obsolete |
mip1 |
| Gene product |
putative guanine
nucleotide binding protein WD repeat protein; facilitates
function of the meiotic regulator Mei2p |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
3942 |
| ORF length (spliced) |
|
| Entry clone length |
3942 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC57A7.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGATAGAATTAGTGA |
| Rev primer name |
SPAC57A7.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAACTCGTTCGGCGAATCC |
| Amino acid length |
1313 |
| Molecular weight |
148.5 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQNPFPNKLNL/LILLSKFLDL/LTRSLKGLAL |
| Localization (YFP) |
cytoplasmic dots,
especially at site of septum formation; cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol)
|
| Microscope used for
observation |
DeltaVision |