| Gene name |
SPBC14F5.07 |
| Gene ID |
39/D05 |
| Gene synonyms/obsolete |
|
| Gene product |
putative mRNA
stability protein zinc finger protein; zf-C3HC4 type (RING
finger); ubiquitin ligase (E3); involved in mRNA stability;
involved in polyadenylation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3898 |
| ORF length (spliced) |
3729 |
| Entry clone length |
3898 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
2493T:C / 3031T:A /
3541T:C / 3772C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC14F5.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACGCAGATGATGAAAT |
| Rev primer name |
SPBC14F5.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTTCGGCAGACTCAGAA |
| Amino acid length |
1242 |
| Molecular weight |
142.3 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
16 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLSTVFVKLKL/LALEILIFLSI/LVSTFCRCLRL/LLVFVPLSL/LRSLMNKLNL/LVMALKYLLL/LGIFILPLLL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |