| Gene name |
SPCC285.14 |
| Gene ID |
39/C01 |
| Gene synonyms/obsolete |
|
| Gene product |
TRAPP; Belongs to the
TMEM1 family; involved in intracellular protein
transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3676 |
| ORF length (spliced) |
3453 |
| Entry clone length |
3676 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
558T:C / 2598T:C /
2808A:G / 2892A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC285.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTAAAAAGAAGCCTAT |
| Rev primer name |
SPCC285.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGTGCATAATCTAGATCC |
| Amino acid length |
1150 |
| Molecular weight |
132.8 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNIPLVNMLFL/LAASFFDLVL/LLSKIILLNL/LKFSMNCLRL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |