| Gene name |
SPAC23G3.01 |
| Gene ID |
39/B12 |
| Gene synonyms/obsolete |
rpb2; SPAC521.06 |
| Gene product |
DNA-directed RNA
polymerase II 138 k DNA-directed RNA polymerase II (subunit);
involved in transcription from Pol II promoter; DNA-directed
RNA polymerase activity (function of complex); DNA-binding
activity (function of complex); RNA binding activity;
interacts physically with Rpb3p; interacts physically with
Rpb11p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3671 |
| ORF length (spliced) |
3633 |
| Entry clone length |
3671 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
36A:G / 672A:G /
1839A:G / 3269T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC23G3.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTATGAGGATTGTAA |
| Rev primer name |
SPAC23G3.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTATGGTTTTTAGTAAAT |
| Amino acid length |
1210 |
| Molecular weight |
137.8 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRSLRRRLDI |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
except nucleolus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |