| Gene name |
SPBC336.01 |
| Gene ID |
38/H09 |
| Gene synonyms/obsolete |
fdh1; fdh |
| Gene product |
DNA helicase; F-box;
stimulated by single-stranded DNA-binding protein at low ATP
concentration; similar to Sp srs2 (paralog); no apparent Sc
ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2677 |
| ORF length (spliced) |
2637 |
| Entry clone length |
2677 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC336.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGCTCAACATTTACA |
| Rev primer name |
SPBC336.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGATCATGTACAGCAAAC |
| Amino acid length |
878 |
| Molecular weight |
99.7 |
| Isoelectric point (calc.) |
8.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |