| Gene name |
SPCC18.04 |
| Gene ID |
38/H05 |
| Gene synonyms/obsolete |
pof6 |
| Gene product |
F-box protein;
essential; involved in cytokinesis; involved in cell
separation (required); involved in endocytic membrane traffic
and recycling out of an early endosome |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2669 |
| ORF length (spliced) |
2619 |
| Entry clone length |
2669 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
147T:C / 645T:C /
2114T:C / 2325C:T / 2445A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC18.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGCCTTCGGAAGCTCG |
| Rev primer name |
SPCC18.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATTATACAGCATGCCAGT |
| Amino acid length |
872 |
| Molecular weight |
99.9 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKEIAHLFI/LHSRIDWLNI |
| Localization (YFP) |
cytosol=nucleus;
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |