Gene name |
SPAPJ760.01c |
Gene ID |
38/F03 |
Gene synonyms/obsolete |
SPAC14C4.15c |
Gene product |
dipeptidyl
aminopeptidase |
Entry clone |
Cloned |
ORF length (unspliced) |
2606 |
ORF length (spliced) |
2562 |
Entry clone length |
2606 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAPJ760.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGCATATGAAGGTGA |
Rev primer name |
SPAPJ760.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCAATATAAAGCGTGATGA |
Amino acid length |
853 |
Molecular weight |
98.3 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
56 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVYGLGSNLFI/LMASVYNFLVI |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |