| Gene name |
SPAC17A5.07c |
| Gene ID |
38/C10 |
| Gene synonyms/obsolete |
ulp2 |
| Gene product |
Ulp1 protease family;
peptidase family C48; cysteine protease; involved in protein
desumoylation; involved in protein deubiquitination |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2360 |
| ORF length (spliced) |
1959 |
| Entry clone length |
2360 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
298T:C / 397G:C /
1353A:G / 1360T:addition / 1399G:C / 1423G:A / 1436T:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC17A5.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCGTATGTTATTCTTTT |
| Rev primer name |
SPAC17A5.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTGTGATTGGCAATATT |
| Amino acid length |
652 |
| Molecular weight |
73.7 |
| Isoelectric point (calc.) |
8.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |