Gene name |
SPAC30D11.03 |
Gene ID |
38/C09 |
Gene synonyms/obsolete |
|
Gene product |
DEAD/DEAH box
helicase; helicase C-terminal domain; involved in 35S
transcript processing; ATP-dependent; RNA helicase |
Entry clone |
Cloned |
ORF length (unspliced) |
2356 |
ORF length (spliced) |
2265 |
Entry clone length |
2356 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
140T:C / 648T:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC30D11.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTTGGAATACGCAGTA |
Rev primer name |
SPAC30D11.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTGCGCTTAGATTTCGAT |
Amino acid length |
754 |
Molecular weight |
85.4 |
Isoelectric point (calc.) |
5.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
717 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus>>nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |