| Gene name |
SPCC1919.15 |
| Gene ID |
37/C09 |
| Gene synonyms/obsolete |
SPCC790.01 |
| Gene product |
zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase (E3); involved
in ubiquitination; involved in histone H2B monoubiquitination;
similar to Sp SPCC970.10C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2079 |
| ORF length (spliced) |
|
| Entry clone length |
2079 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
204T:C / 1100T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1919.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCGTTGTGAATGAATC |
| Rev primer name |
SPCC1919.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGATGAATGGTCAAAATG |
| Amino acid length |
692 |
| Molecular weight |
80.7 |
| Isoelectric point (calc.) |
6.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
7/8 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |