| Gene name |
SPBC800.03 |
| Gene ID |
37/C08 |
| Gene synonyms/obsolete |
clr3 |
| Gene product |
histone deacetylase;
NAD-independent histone deacetylase activity; histone
deacetylase (H3 K14 specific); HDA1-like (class II); cryptic
loci regulator; involved in chromatin silencing; involved in
chromatin silencing of rDNA (required); involved in chromatin
silencing at silent mating type cassettes (sensu Fungi)
(required) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2064 |
| ORF length (spliced) |
|
| Entry clone length |
2064 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1444A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC800.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTGGCCTCTAATTCTGA |
| Rev primer name |
SPBC800.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGAGAAGTTGGTCGGGCC |
| Amino acid length |
687 |
| Molecular weight |
76.7 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSEVKELCL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |