| Gene name |
SPBC4B4.04 |
| Gene ID |
36/B10 |
| Gene synonyms/obsolete |
|
| Gene product |
translation initiation
factor eIF2A |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1769 |
| ORF length (spliced) |
1731 |
| Entry clone length |
1769 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
811A:G / 872A:T /
1208T:C / 1516C:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC4B4.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTCAAAAAAGCCAGTT |
| Rev primer name |
SPBC4B4.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCATCCGGTGTCCATCCA |
| Amino acid length |
576 |
| Molecular weight |
63.4 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica;
DeltaVision |