| Gene name |
SPCC584.08 |
| Gene ID |
36/B09 |
| Gene synonyms/obsolete |
cwf13; snw1;
SPCC188.11 |
| Gene product |
SNW family; chromatin
binding; complexed with Cdc5p; involved in mRNA splicing;
SKIP/SNW domain; interacts with the small subunit of
U2AF |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1765 |
| ORF length (spliced) |
1674 |
| Entry clone length |
1765 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
965T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC584.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCCCTTTTATCCGAAGA |
| Rev primer name |
SPCC584.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTTTTCTTTGAAGAAACA |
| Amino acid length |
557 |
| Molecular weight |
62.6 |
| Isoelectric point (calc.) |
9.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB; nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |