| Gene name |
SPCC1235.14 |
| Gene ID |
34/E03 |
| Gene synonyms/obsolete |
ght5 |
| Gene product |
hexose transporter;
similar to Sp GHT1 and GHT2 and GHT4 and GHT3 and GHT6 and
SPCC548.06C and SPBC1348.14C; tandem duplication |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1641 |
| ORF length (spliced) |
|
| Entry clone length |
1641 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC1235.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAAAAAATTTGACCAT |
| Rev primer name |
SPCC1235.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCGAATTGTTCTTCCTGA |
| Amino acid length |
546 |
| Molecular weight |
60.3 |
| Isoelectric point (calc.) |
5.8 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEEINELYI |
| Localization (YFP) |
periphery with
discontinuity |
| Comments for localization |
periphery except
septum |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |