| Gene name |
SPBC16C6.02c |
| Gene ID |
34/D07 |
| Gene synonyms/obsolete |
|
| Gene product |
involved in
intracellular protein transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
9808 |
| ORF length (spliced) |
9396 |
| Entry clone length |
9808 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
1757C:T / 4432A:G /
7406T:C / 9782T:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC16C6.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTAGAAGGGTTACTAGC |
| Rev primer name |
SPBC16C6.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGGTTCGCTTGAGGAACTA |
| Amino acid length |
3131 |
| Molecular weight |
354 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDVLELNLDI/LAKFSILTL/LHCGISELLI/LASNLPEMLSI/LIKMASLAI/LACLYPLRI/LQLNILPTLQI/LSLEVEDRLVL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |