| Gene name |
SPBC21C3.01c |
| Gene ID |
34/D05 |
| Gene synonyms/obsolete |
vps13a;
SPBC31F10.18c |
| Gene product |
involved in
intracellular protein transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
9318 |
| ORF length (spliced) |
9216 |
| Entry clone length |
9318 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
511A:G / 593T:C /
990T:C / 2238A:G / 2737T:C / 3872A:C / 5236T:C / 6312T:C /
6631T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC21C3.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTAGAAGGCCTAGTTGC |
| Rev primer name |
SPBC21C3.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGAGCAACCTCTAGCTCG |
| Amino acid length |
3071 |
| Molecular weight |
354 |
| Isoelectric point (calc.) |
6.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
358 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIVHLRTLVI/LPMFFGELLI/LRTTVNDFLFL/LHDLPLLNI/LLEVKNLLPI |
| Localization (YFP) |
cytosol; ambiguous
structure |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |