| Gene name |
SPAC15A10.11 |
| Gene ID |
34/C02 |
| Gene synonyms/obsolete |
ubr11 |
| Gene product |
ubiquitin ligase (E3);
N-end-recognizing protein; zinc finger protein; zf-C3HC4 type
(RING finger); zf-UBR1 type; similar to Sp ubr1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
6159 |
| ORF length (spliced) |
|
| Entry clone length |
6159 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
149T:C / 642A:G /
1108A:G / 3411G:A / 4855T:G / 6146G:A / 6147G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC15A10.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAATTGCACGACCCGCC |
| Rev primer name |
SPAC15A10.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCCATTCGCCAGTTTTGC |
| Amino acid length |
2052 |
| Molecular weight |
234 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLAQIDCNLWI/LMFVDPNLVL/LCKMLELLI |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |