| Gene name |
SPBC19C7.02 |
| Gene ID |
34/B12 |
| Gene synonyms/obsolete |
ubr1;
SPBC32F12.14 |
| Gene product |
ubiquitin ligase (E3);
N-end-recognizing protein; zinc finger protein; zf-C3HC4 type
(RING finger); zf-UBR1 type; similar to Sp ubr11 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5877 |
| ORF length (spliced) |
|
| Entry clone length |
5877 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
787A:G /
1511T:deletion/ 2294C:T / 5394T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC19C7.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTACAAGACGAGTCTAG |
| Rev primer name |
SPBC19C7.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGTGTTTCCCAACCTCCG |
| Amino acid length |
1958 |
| Molecular weight |
225.7 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |