| Gene name |
SPAC25G10.04c |
| Gene ID |
33/G11 |
| Gene synonyms/obsolete |
rec10 |
| Gene product |
involved in meiotic
recombination (required); involved in sister chromatid
cohesion; no apparent orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2376 |
| ORF length (spliced) |
|
| Entry clone length |
2376 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
909T:C / 1651G:A /
2051C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC25G10.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACATATTTTCTGAGTT |
| Rev primer name |
SPAC25G10.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTAAACATCAAACTGTCA |
| Amino acid length |
791 |
| Molecular weight |
89.8 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
485 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIESFTSLEI |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |