| Gene name |
SPAC16.02c |
| Gene ID |
33/D01 |
| Gene synonyms/obsolete |
srp2 |
| Gene product |
RNA-binding protein;
involved in mRNA splicing; no apparent Sc ortholog; rrm RNA
recognition motif |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1716 |
| ORF length (spliced) |
1098 |
| Entry clone length |
1716 |
| No. of intron |
9 |
| Sequence status |
Finished |
| Sequence results |
857A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC16.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGGAGACTAGATTGTT |
| Rev primer name |
SPAC16.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCATTCAGCAGCGACCTGT |
| Amino acid length |
365 |
| Molecular weight |
42.5 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
74 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
almost no apparent
signal; nucleus and mitochondrion? |
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |