| Gene name |
SPBC29B5.01 |
| Gene ID |
33/C12 |
| Gene synonyms/obsolete |
atf1; mts1; sss1;
gad7 |
| Gene product |
transcription factor;
involved in sexual development (required); involved in entry
into stationary phase(required); involved in G1 arrest;
involved in gene expression under nitrogen starvation
(required); heterodimeric transcriptional activator; involved
in meiotic recombination; binds M26 recombination hotspot;
involved in oxidative stress response; target for the Sty1p
stress-activated MAP kinase pathway; bZIP (basic leucine
zipper) transcription factor family; overexpression suppresses
calcium sensitivity of Atf1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1701 |
| ORF length (spliced) |
|
| Entry clone length |
1701 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
516T:C / 654T:C /
1283A:G / 1287T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC29B5.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCCCGTCTCCCGTCAA |
| Rev primer name |
SPBC29B5.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTACCCTAAATTGATTCTT |
| Amino acid length |
566 |
| Molecular weight |
59.7 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots;
nucleus |
| Comments for localization |
large nuclear dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |