| Gene name |
SPBC2F12.09c |
| Gene ID |
32/D09 |
| Gene synonyms/obsolete |
atf21 |
| Gene product |
atf creb-family
transcription factor; bZIP (basic leucine zipper)
transcription factor family; involved in regulation of
conjugation (regulation), regulation of meiosis; similar to Sp
atf1 and pcr1 (paralogs); no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1068 |
| ORF length (spliced) |
|
| Entry clone length |
1068 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC2F12.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTTCGCAAATGTGTA |
| Rev primer name |
SPBC2F12.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATGTTTCTGAAAGGACATA |
| Amino acid length |
355 |
| Molecular weight |
39.4 |
| Isoelectric point (calc.) |
7.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
268 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |