Gene name |
SPBC2F12.09c |
Gene ID |
32/D09 |
Gene synonyms/obsolete |
atf21 |
Gene product |
atf creb-family
transcription factor; bZIP (basic leucine zipper)
transcription factor family; involved in regulation of
conjugation (regulation), regulation of meiosis; similar to Sp
atf1 and pcr1 (paralogs); no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1068 |
ORF length (spliced) |
|
Entry clone length |
1068 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC2F12.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTTCGCAAATGTGTA |
Rev primer name |
SPBC2F12.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATGTTTCTGAAAGGACATA |
Amino acid length |
355 |
Molecular weight |
39.4 |
Isoelectric point (calc.) |
7.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
268 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |