Gene name |
SPAC683.02c |
Gene ID |
31/G06 |
Gene synonyms/obsolete |
SPAC694.01c |
Gene product |
zinc finger protein;
zf-CCHC type (zinc knuckle) |
Entry clone |
Cloned |
ORF length (unspliced) |
657 |
ORF length (spliced) |
|
Entry clone length |
657 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
509A:G / 567T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC683.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCACGAATAACAAACAT |
Rev primer name |
SPAC683.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAACGTAACCAACTTTTTC |
Amino acid length |
218 |
Molecular weight |
24.6 |
Isoelectric point (calc.) |
9.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
204 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleolus>nucleus |
Microscope used for
observation |
Confocal |