| Gene name |
SPBC215.04 |
| Gene ID |
31/C05 |
| Gene synonyms/obsolete |
git11 |
| Gene product |
G gamma subunit of the
gpa2/git5/git11 heterotrimeric G protein; no apparent
orthologs; glucose/cAMP pathway; related to Sc YJR086W but not
functional ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
308 |
| ORF length (spliced) |
219 |
| Entry clone length |
308 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC215.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAACAGAGGCTTTATT |
| Rev primer name |
SPBC215.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGAAATAGTACAGCATTTG |
| Amino acid length |
72 |
| Molecular weight |
7.9 |
| Isoelectric point (calc.) |
9.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |