| Gene name |
SPCC5E4.04 |
| Gene ID |
31/B09 |
| Gene synonyms/obsolete |
cut1 |
| Gene product |
separin; separase;
involved in mitotic regulation and sister chromatid
separation; promotes anaphase; loaded onto the metaphase
spindle by Cut2p; peptidase family C50; shows proteolytic
activity toward Rad21/Scc1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5605 |
| ORF length (spliced) |
5487 |
| Entry clone length |
5605 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
1573T:C /
5236A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC5E4.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTACAAGGTCAATCGT |
| Rev primer name |
SPCC5E4.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGGAATAATATAAGCAGGT |
| Amino acid length |
1828 |
| Molecular weight |
209.4 |
| Isoelectric point (calc.) |
7.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
1717 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNVLRCLSL/LQSFKLLIL/LHTTFNQLDL/LTFELAFLEI/LHLQFSKYLVI/LSRTVSLNLLL/LTKGIKRLSL/LDYLRERLKI/LEQILNSRLSI/LSPEILELFI/LEDLIYFILDI |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |