| Gene name |
SPAC1F5.04c |
| Gene ID |
31/B07 |
| Gene synonyms/obsolete |
cdc12 |
| Gene product |
formin; actin-binding
protein; essential; profilin-binding protein; interacts
physically with Cdc3p; involved in contractile ring assembly,
cytokinesis, cell polarity, F-actin capping, and actin
nucleation; ts mutant has defective septum pattern; similar to
Sp fus1 and for1; possibly travels on both microtubule and
actin networks to the future site of cell division |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5526 |
| ORF length (spliced) |
|
| Entry clone length |
5526 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
2510G:A / 2698A:G /
3110A:G / 3616G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1F5.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGAAATTCGTCAAAGGG |
| Rev primer name |
SPAC1F5.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTCTCATTCTCCTTAGGC |
| Amino acid length |
1841 |
| Molecular weight |
207.5 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery at site of
septum formation; cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |