| Gene name |
SPCC830.01c |
| Gene ID |
31/B02 |
| Gene synonyms/obsolete |
SPCC1620.14c |
| Gene product |
SNF2 family; helicase
C-terminal domain; AT hook protein; bromodomain protein;
similar to Sp SPAC1250.01 (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5043 |
| ORF length (spliced) |
|
| Entry clone length |
5043 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
621T:C / 756A:G /
1281T:C / 4232T:C / 4932T:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC830.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTGCTGTTCAAGGGAA |
| Rev primer name |
SPCC830.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCCGAATAAGAAGAAGAA |
| Amino acid length |
1680 |
| Molecular weight |
189.9 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
1445 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots; nuclear
dots on spindle |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |