| Gene name |
SPAC31A2.05c |
| Gene ID |
31/B01 |
| Gene synonyms/obsolete |
mis4 |
| Gene product |
adherin; sister
chromatid cohesion molecule; chromatin associated; involved in
S phase and spindle kinetochore attachment |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5040 |
| ORF length (spliced) |
4752 |
| Entry clone length |
5040 |
| No. of intron |
7 |
| Sequence status |
Finished |
| Sequence results |
617A:T / 846T:C /
949A:G / 1012T:C / 1233A:C / 3071T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC31A2.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACACCTGAAACCTTTAA |
| Rev primer name |
SPAC31A2.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACAACTGTAAGCTGTTCC |
| Amino acid length |
1583 |
| Molecular weight |
180.2 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLQKVANVLNI/LLEDLLNMLSL/LNLKFFVSLII/LFDLSYLHL/LIMQILKPLKL |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |