| Gene name |
SPAC29B12.01 |
| Gene ID |
31/A05 |
| Gene synonyms/obsolete |
SPAC3G6.12 |
| Gene product |
SNF2 family; helicase
C-terminal domain; DEAD/DEAH box helicase |
| Entry clone |
Cloned#/2005 |
| ORF length (unspliced) |
4815 |
| ORF length (spliced) |
|
| Entry clone length |
4815 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
Partially
sequenced. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC29B12.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATCCTTCCAGAGAAAC |
| Rev primer name |
SPAC29B12.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCTTCTAATAGCCATGAA |
| Amino acid length |
1604 |
| Molecular weight |
183 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |