| Gene name |
SPAC343.11c |
| Gene ID |
31/A04 |
| Gene synonyms/obsolete |
|
| Gene product |
zinc finger protein;
zf-C5HC2 type; jmjC domain; jmjN domain; similar to
retinoblastoma binding proteins; involved in transcriptional
regulation; overexpression supresseses chk1 mutant;
non-essential; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4767 |
| ORF length (spliced) |
|
| Entry clone length |
4767 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
187A:G / 519A:G /
698T:C / 754T:C / 4198A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC343.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGGAAAAATTCATCTCA |
| Rev primer name |
SPAC343.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATGCTGAGGTATGTTTCA |
| Amino acid length |
1588 |
| Molecular weight |
180.3 |
| Isoelectric point (calc.) |
6.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
845/844 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGKAVDLLQI/LKDRVDRELTL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |