| Gene name |
SPAC22F3.04 |
| Gene ID |
30/H07 |
| Gene synonyms/obsolete |
|
| Gene product |
AMP binding enzyme;
similar to Sp SPAC56F8.02 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4501 |
| ORF length (spliced) |
4287 |
| Entry clone length |
4501 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
1695A:G /
2674A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC22F3.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAACCTTCAGAAAACGA |
| Rev primer name |
SPAC22F3.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGGAGATTAAGTTGGGAA |
| Amino acid length |
1428 |
| Molecular weight |
162.3 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSKVMIPLNI/LDFIWNTLEL |
| Localization (YFP) |
SPB?; cytoplasmic
dots; cytosol |
| Comments for localization |
nuclear dots by over
expression? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |