| Gene name |
SPAC22F8.08 |
| Gene ID |
29/D08 |
| Gene synonyms/obsolete |
sec24 |
| Gene product |
SEC23/SEC24 family;
SEC24 subfamily; COPII-coated vesicle component; involved in
intracellular protein transport; involved in ER to Golgi
transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2781 |
| ORF length (spliced) |
|
| Entry clone length |
2781 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
21C:T / 712T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC22F8.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTCAGGAGGACGCTTT |
| Rev primer name |
SPAC22F8.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTCACGAACTTTCTCTTTA |
| Amino acid length |
926 |
| Molecular weight |
101.9 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRLLPLLCL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |