| Gene name |
SPAC7D4.04 |
| Gene ID |
29/D07 |
| Gene synonyms/obsolete |
|
| Gene product |
involved in response
to nitrogen starvation (required); involved in nitrogen
starvation-induced sexual development (required); involved in
G0 phase transition (required); interacts physically with
Taz1p; predicted coiled-coil region |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2781 |
| ORF length (spliced) |
|
| Entry clone length |
2781 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
2432A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC7D4.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGTTTTCGATTGAATGA |
| Rev primer name |
SPAC7D4.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAATCTTTCATCGATAGCT |
| Amino acid length |
926 |
| Molecular weight |
106.7 |
| Isoelectric point (calc.) |
5.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVAWIMELNI |
| Localization (YFP) |
cytoplasmic dots;
nuclear dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |